SSAA09E2 is a novel inhibitor of SARS-CoV replication, acting by blocking early interactions of SARS-S with the receptor for SARS-CoV, Angiotensin Converting Enzyme-2 (ACE2)

​​COE2-2hexyl​​ represents an innovative class of antimicrobial agents, demonstrating broad-spectrum antibacterial activity through its unique conjugated oligoelectrolyte (COE) structure.

Furamidine (DB75) is abisbenzamidine derivative and an antiparasite agent. Furamidine is a potent, reversible and competitive tyrosyl-DNA phosphodiesterase 1 (TDP-1) inhibitor. Inhibition of TDP-1 by Furamidine is effective both with single- and double-stranded DNA substrates but is slightly stronger with the duplex DNA. Furamidine is also a selective and cell-permeable protein arginine methyltransferase 1 (PRMT1) inhibitor with an IC50 of 9.4 μM. Furamidine is selective for PRMT1 over PRMT5, PRMT6, and PRMT4 (CARM1) (IC50s of 166 µM, 283 µM, and >400 µM, respectively).

mCLB073 is an advanced, orally active small molecule agonist specifically designed to target Mtb adenylyl cyclase Rv1625c. As an optimized derivative of V-59, it demonstrates significantly enhanced potency and efficacy for in vivo applications. In cholesterol-based media, mCLB073 shows a remarkable 17-fold increase in activity against Mtb compared to its predecessor, V-59, while retaining favorable pharmacokinetic characteristics and a strong safety profile. In preclinical studies, oral administration of mCLB073 at 30 mg/kg led to a substantial reduction in Mtb colony-forming units (CFUs) in the lungs of mice, accompanied by a 45% decrease in lung pathology severity. These findings highlight its potential as a promising therapeutic candidate for tuberculosis treatment.

ATV006 is a potent, orally active antiviral agent and ester prodrugs of GS-441524. ATV006 inhibits the replication of SARS-CoV-2 and its variants. ATV006 can be used for SARS-CoV-2 research.

Savirin (S. aureus virulence inhibitor) is a small molecule that targets the agr (accessory gene regulator) quorum sensing system in Staphylococcus aureus (S. aureus). The agr system is a key regulatory pathway that controls the expression of virulence factors in S. aureus, which are critical for its pathogenicity. The system involves a two-component signal transduction pathway consisting of AgrC (a histidine kinase) and AgrA (a response regulator).

Xeruborbactam (QPX7728) is an ultrabroad-spectrum beta-lactamase inhibitor with remarkable activity against a wide range of beta-lactamases, including those that are typically resistant to other inhibitors.

Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).

Bersacapavir is a novel Hepatitis B Virus capsid assembly modulator.

MMV666810, a 2-aminopyrazine similar to MMV390048, is potent against asexual parasites at 5.94 nM, but against gametocytes, it has a 3.3-fold selectivity to late-stage gametocytes compared to earlier stages (early-stage gametocyte: IC50 603 ± 88 nM; late-stage gametocyte: IC50 179 ± 8 nM).

MMV674850 is potent against asexual stage parasites at 2.7 and 4.5 nM and preferentially targets early-stage gametocytes (early-stage gametocyte: IC50 4.5 ± 3.6 nM; late-stage gametocyte: IC50 28.7 ± 0.2 nM).

Pyribencarb is a benzylcarbamate-type fungicide, which is active against a wide range of plant pathogenic fungi. Pyribencarb is a potent Qo inhibitor of cytochrome b. Pyribencarb is especially active against Botrytis cinerea and Sclerotinia sclerotirum.

Cilastatin sodium (MK0791 sodium) is a reversible, competitive renal dehydropeptidase I inhibitor with an IC50 of 0.1 μM. Cilastatin sodium inhibits the bacterial metallob-lactamase enzyme CphA with an IC50 of 178 μM. Cilastatin sodium is an antibacterial adjunct.

Vancomycin hydrochloride in stock,price: 500 USD/100mg. 0

Pneumocandin B0 is the major analogue of a family of lipopeptides isolated from several species of several different genera, notably Cryptosporiopsis, Glarea and Pezicula. Pneumocandin B0 is a potent antifungal and acts by inhibition of the synthesis of β

Emodepside (PF 1022-221) is a cyclooctadepsipeptide with broad-spectrum anthelmintic activity.

Fidaxomicin, is an antibiotic that belongs to the class of macrocylic antibiotics.

DuP-721 is a broad spectrum and orally active antibacterial agent against a variety of clinically susceptible and resistant bacteria, especially M. tuberculosis.

SB27012 (SB 27012) is a small molecule PPI inhibitor of the Spike RBD-ACE2 interaction (IC50=7.7 uM in ELISA assays), binds ACE2 (Kd=210 nM) without affecting ACE2 enzymatic activity.

Phenazine methylsulfate is a free radical generator. Phenazine methylsulfate has been used as an electron transfer reactant in cell viability assays. Phenazine methylsulfate induces ssDNA break formation in the presence of the reducing agent NADPH. Phenazine methylsulfate induces oxidative DNA damage in an alkaline comet assay and apoptosis.

A potent HCV NS5B RNA polymerase inhibitor.

Moxifloxacin(Avelox, Avalox) is a fourth generation synthetic fluoroquinolone antibacterial agent.

Amprenavir (Agenerase) is a HIV protease inhibitor(Ki=0.6 nM) used to treat HIV infection.

Ro 20-0657/000 is a metabolite of Trimethoprim. Trimethoprim is a dihydrofolate reductase inhibitor, used as an antibacterial agent in human and veterinary medicine.

Phenoxyethanol has a broad spectrum of antimicrobial activity against various gram-negative and gram-positive bacteria. Phenoxyethanol is an uncouple agent in oxidative phosphorylation from respiration and competitively inhibits malate dehydrogenase. Phenoxyethanol is used as a preservative in cosmetic, vaccine, and textile, et al.

Alisporivir (Debio-025) is a cyclophilin inhibitor molecule with potent anti-hepatitis C virus (HCV) activity.

GPS491 (EC50 = 0.47 μM) suppresses expression of the HIV-1 structural protein Gag and alters HIV-1 RNA accumulation, decreasing the abundance of RNAs encoding the structural proteins while increasing levels of viral RNAs encoding the regulatory proteins.

GSK 3011724A (DG-167, GSK-3011724A) is a potent, specific inhibitor of β-ketoacyl-ACP synthase (KasA, Kd=9 nM), shows anti-tubercular activity (MIC H37Rv=0.8 uM); shows much weaker apparent dissociation constant for both Pks10 and Pks (Kd=1.4 uM); inhibits mycolic acid biosynthesis and shows negligible activity against a panel of unrelated proteins and 18 Gram-positive and Gram-negative bacterial species.

Q308 is a small molecule that silences the latent HIV-1 provirus by inhibiting Tat-mediated gene transcription and selectively downregulates the expression levels of the facilitated chromatin transcription (FACT) complex.Q308 induced the preferential apoptosis in HIV-1 latently infected cells, Q308 may reduce the size of the viral reservoir.

Enfumafungin, a triterpene glycoside, is isolated from extracts derived from an endophytic species of Hormonema. Enfumafungin is an antifungal compound that is acting on the fungal cell wall, as the (1,3)-beta-D-glucan synthase inhibitor. Enfumafungin is specific for yeasts and fungi (excluding Cryptococcus) and does not inhibit the growth of Bacillus subtilis[1][2].