Alternate TextTo enhance service speed and avoid tariff delays, we've opened a US warehouse. All US orders ship directly from our US facility.
Home > Inhibitors & Agonists > Antibiotics and Antivirals > HBV

HBV

You can also try the following methods, and our professionals will serve you Customized Consultation
Cat. No. Product Name Field of Application Chemical Structure
DC71481 Bepirovirsen Featured
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).
More description
DC47062 Bersacapavir Featured
Bersacapavir is a novel Hepatitis B Virus capsid assembly modulator.
More description
DC72983 ZINC20451377 Featured
ZINC20451377 is a small molecule that binds to hepatitis B surface antigen (HBsAg) with high affinity (Kd=65.3 nM), reduces HBsAg levels and HBV virion secretion in cell culture model for HBV.
More description
DC72290 DVR-01 Featured
DVR-01 is a HBV inhibitor with EC50 values of 1.7 and 1.6 μM in AML12HBV10 and HepDES19 cells, respectively. DVR-01 shows antiviral activity against drug-resistant HBV mutants with EC50s of 2.403-3.273 μM. DVR-01 can be used for the research of HBV infection and related diseases.
More description
DC72982 SAG-524
SAG-524 (SAG524) is a potent and orally bioavailable small molecule inhibitor of HBV replication, reduces HBsAg and HBV-DNA (IC50 = 0.92 nM and 1.4 nM) by destabilizing HBV-RNA.
More description
DC72981 Neracorvir
Neracorvir is a potent anti-HBV agent, targets HBV surface antigen.
More description
DC72980 E-CFCP
E-CFCP is a novel long-acting nucleotide reverse transcriptase inhibitor (NRTI) against HBV, shows potent activity against HBV WTD1 and HBV WTC2 with IC50 of 1.8 and 0.7 nM, respectively.
More description
DC72979 DF-006
DF-006 is a small molecule, orally active Alpha-kinase 1 (ALPK1) agonist, activates ALPK1 and stimulates host innate immunity locally in liver, DF-006 enacts potent anti-HBV responses in mouse models of HBV and in primary human hepatocytes.
More description
DC11296 GLP-26 Featured
GLP-26 is a novel potent HBV capsid modulator that reduces secreted HBeAg in HepNTCPDL cells transfected with HBV wild type with EC50 of 0.7 uM.
More description
DC47259 Inarigivir ammonium Featured
Inarigivir (ORI-9020) ammonium is a dinucleotide antiviral drug which can significantly reduce liver HBV DNA in transgenic mice expressing hepatitis B virus. Inarigivir (ORI-9020) act as an RIG-I agonist to activate cellular innate immune responses.
More description
DC10882 JNJ-632 Featured
JNJ-632 is a novel and potent inhibitor of HBV replication in vitro across genotypes A-D.
More description
DC10797 AB-423 Featured
AB-423 is the first-generation Hepatitis B Virus Capsid Assembly inhibitor, which was generally safe and well tolerated in Phase 1 healthy volunteer studies.
More description
DC72577 ccc_R08
ccc_R08 is a non-cytotoxic and orally active cccDNA inhibitor that reduces cccDNA levels in the liver of HBV-infected mice. ccc_R08 can be used in the study of HBV virus (hepatitis B virus) infection.
More description
DC72576 cis-ccc_R08
cis-ccc_R08 (compound 1) is a flavonoid derivative that can be used in the study of hepatitis B virus (HBV) infection. cis-ccc_R08 is a cccDNA (covalently closed circular DNA) inhibitor.
More description
DC72575 trans-ccc_R08
trans-ccc_R08 (compound 1-B) is a potent cccDNA (covalently closed circular DMA) inhibitor. trans-ccc_R08 inhibits HBeAg level with an IC50 value of 0.08 µM. trans-ccc_R08 has the potential for the research of Hepatitis B Virus infection (HBV).
More description
DC72574 Lagociclovir valactate
Lagociclovir valactate is a prodrug of Lagociclovir. Lagociclovir valactate is an orally active anti-HBV agent.
More description
DC10085 Bay 41-4109 (racemate) Featured
BAY 41-4109 racemate is a potent inhibitor of human hepatitis B virus (HBV) with an IC50 of 53 nM.
More description
DC72289 AB-836
AB-836 is an orally active HBV capsid inhibitor. AB-836 inhibits viral replication by interacting with HBV core protein.
More description
DC72151 (-)-5′-Noraristeromycin
(-)-5′-Noraristeromycin is an antiviral agent. (-)-5′-Noraristeromycin also is an enantiomer of 5'-noraristeromycin and can inhibit intracellular HBV replication and virion production. (-)-5′-Noraristeromycin can be used for the research of cancer.
More description
DC71480 Canocapavir
Canocapavir (ZM-H1505R) has orally antiviral activity. Canocapavir is a HBV capsid inhibitor that can be used in the research of Chronic hepatitis B. .
More description
DC71479 (1R)-Tenofovir amibufenamide
(1R)-Tenofovir amibufenamide ((1R)-HS-10234) is the isomer of Tenofovir amibufenamide, is an orally active antiviral agent. (1R)-Tenofovir amibufenamide ((1R)-HS-10234) is a HIV infection inhibitor and HBV infection inhibitor. (1R)-Tenofovir amibufenamide ((1R)-HS-10234) can be used for HIV infections, hepatitis B research.
More description
DC70733 Rencofilstat
Rencofilstat (CRV431) is a non-immunosuppressive analogue of cyclosporine A and pan-cyclophilin inhibitor, potently inhibits cyclophilin isoforms A, B, D, and G with IC50 of 1-7 nM.Rencofilstat (CRV431) is more than 13 times more potent than the parent compound, cyclosporine A (CsA).Rencofilstat (CRV431) inhibits liver HBV DNA and HBsAg, reduces liver HBV DNA levels and moderately decreased serum HBsAg levels in HBV transgenic mouse model.Rencofilstat (CRV431) shows potential as a drug candidate for chronic liver diseases.
More description
DC70167 AB-506
AB-506 is a small-molecule inhibitor targeting HBV core protein, inhibits viral replication in vitro (IC50=77 nM).AB-506 binds to HBV core protein, accelerates capsid assembly and inhibits HBV pgRNA encapsidation.AB-506 blocks cccDNA establishment in HBV-infected HepG2-hNTCP-C4 cells and primary human hepatocytes, leading to inhibition of viral RNA, HBsAg, and HBeAg production (EC50=0.64-1.52 uM).AB-506 demonstrated activity across HBV genotypes A-H and maintains antiviral activity against nucleostide analog-resistant variants in vitro.AB-506 showed an 8 to 20-fold increase in EC50 values against L30F, L37Q, and I105T substitutions.AB-506 exhibits good oral bioavailability, systemic exposure, and higher liver to plasma ratios in rodents.
More description
DC70166 AB-452
AB-452 (AB452) is a potent, small molecule inhibitor of noncanonical poly(A) polymerases PAPD5 and PAPD7 (PAPD5/7), inhibits PAPD5/7 enzymatic activities, reduces HBsAg in vitro (EC50=1.4/6.8 nM).AB-452 demonstrated specific antiviral activity for HBV, was inactive against a panel of 10 different RNA and DNA viruses with EC50 values of >30 uM.AB-452 reduced HBsAg, HBeAg, and HBV DNA production with EC50 of 0.28-6.8 nM, without cytotoxicity.AB-452 interferes with multiple steps of HBV life cycle by reducing HBV RNA.AB-452 demonstrated antiviral activity in AAV-HBV-transduced mouse model.AB-452 promotes HBV RNA degradation through inhibiting PAPD5 and PAPD7 enzymatic activities and blockage of guanosine incorporation into viral RNA poly(A) tails..
More description
DC49479 HBV-IN-14
HBV-IN-14 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-14 is a pyridinopyrimidinones compound. HBV-IN-14 has the potential for the research of HBV infection (extracted from patent WO2021190502A1, compound 5).
More description
DC49478 HBV-IN-16
HBV-IN-16 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-16 is a quinoline derivative. HBV-IN-16 has the potential for the research of HBV infection (extracted from patent WO2019121357A1, compound 1).
More description
DC49477 SHR5133
SHR5133 is a highly potent, orally active HBV capsid assembly modulator. SHR5133 displays HBV DNA reduction (EC50=26.6 nM).
More description
DC49476 HBV-IN-17
HBV-IN-17 (compound 8) is a potent HBV capsid assembly modulator with an EC50 of 511 nM.
More description
DC49475 BA38017
BA38017 is a potent HBV core protein assembly modulator. BA38017 inhibits HBV replication with an EC50 of 0.20 μM.
More description
DC49059 TLR8 agonist 4
TLR8 agonist 4 showed effective inhibition on wild-type and drug-resistant (lamivudine and entecavir) HBV strains. The IC50 values are 0.15 and 0.10 respectively μM.
More description

Customized Consultation X

Your information is safe with us. * Required Fields.

Your name
Company
Email
Procuct Name
Cat. No.
Remark
Verification code
Please fill out the characters in the picture
X