Cat. No. | Product Name | Field of Application | Chemical Structure |
---|---|---|---|
DC71481 | Bepirovirsen Featured |
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).
More description
|
![]() |
DC47062 | Bersacapavir Featured |
Bersacapavir is a novel Hepatitis B Virus capsid assembly modulator.
More description
|
![]() |
DC72983 | ZINC20451377 Featured |
ZINC20451377 is a small molecule that binds to hepatitis B surface antigen (HBsAg) with high affinity (Kd=65.3 nM), reduces HBsAg levels and HBV virion secretion in cell culture model for HBV.
More description
|
![]() |
DC72290 | DVR-01 Featured |
DVR-01 is a HBV inhibitor with EC50 values of 1.7 and 1.6 μM in AML12HBV10 and HepDES19 cells, respectively. DVR-01 shows antiviral activity against drug-resistant HBV mutants with EC50s of 2.403-3.273 μM. DVR-01 can be used for the research of HBV infection and related diseases.
More description
|
![]() |
DC72982 | SAG-524 |
SAG-524 (SAG524) is a potent and orally bioavailable small molecule inhibitor of HBV replication, reduces HBsAg and HBV-DNA (IC50 = 0.92 nM and 1.4 nM) by destabilizing HBV-RNA.
More description
|
![]() |
DC72981 | Neracorvir |
Neracorvir is a potent anti-HBV agent, targets HBV surface antigen.
More description
|
![]() |
DC72980 | E-CFCP |
E-CFCP is a novel long-acting nucleotide reverse transcriptase inhibitor (NRTI) against HBV, shows potent activity against HBV WTD1 and HBV WTC2 with IC50 of 1.8 and 0.7 nM, respectively.
More description
|
![]() |
DC72979 | DF-006 |
DF-006 is a small molecule, orally active Alpha-kinase 1 (ALPK1) agonist, activates ALPK1 and stimulates host innate immunity locally in liver, DF-006 enacts potent anti-HBV responses in mouse models of HBV and in primary human hepatocytes.
More description
|
![]() |
DC11296 | GLP-26 Featured |
GLP-26 is a novel potent HBV capsid modulator that reduces secreted HBeAg in HepNTCPDL cells transfected with HBV wild type with EC50 of 0.7 uM.
More description
|
![]() |
DC47259 | Inarigivir ammonium Featured |
Inarigivir (ORI-9020) ammonium is a dinucleotide antiviral drug which can significantly reduce liver HBV DNA in transgenic mice expressing hepatitis B virus. Inarigivir (ORI-9020) act as an RIG-I agonist to activate cellular innate immune responses.
More description
|
![]() |
DC10882 | JNJ-632 Featured |
JNJ-632 is a novel and potent inhibitor of HBV replication in vitro across genotypes A-D.
More description
|
![]() |
DC10797 | AB-423 Featured |
AB-423 is the first-generation Hepatitis B Virus Capsid Assembly inhibitor, which was generally safe and well tolerated in Phase 1 healthy volunteer studies.
More description
|
![]() |
DC72577 | ccc_R08 |
ccc_R08 is a non-cytotoxic and orally active cccDNA inhibitor that reduces cccDNA levels in the liver of HBV-infected mice. ccc_R08 can be used in the study of HBV virus (hepatitis B virus) infection.
More description
|
![]() |
DC72576 | cis-ccc_R08 |
cis-ccc_R08 (compound 1) is a flavonoid derivative that can be used in the study of hepatitis B virus (HBV) infection. cis-ccc_R08 is a cccDNA (covalently closed circular DNA) inhibitor.
More description
|
![]() |
DC72575 | trans-ccc_R08 |
trans-ccc_R08 (compound 1-B) is a potent cccDNA (covalently closed circular DMA) inhibitor. trans-ccc_R08 inhibits HBeAg level with an IC50 value of 0.08 µM. trans-ccc_R08 has the potential for the research of Hepatitis B Virus infection (HBV).
More description
|
![]() |
DC72574 | Lagociclovir valactate |
Lagociclovir valactate is a prodrug of Lagociclovir. Lagociclovir valactate is an orally active anti-HBV agent.
More description
|
![]() |
DC10085 | Bay 41-4109 (racemate) Featured |
BAY 41-4109 racemate is a potent inhibitor of human hepatitis B virus (HBV) with an IC50 of 53 nM.
More description
|
![]() |
DC72289 | AB-836 |
AB-836 is an orally active HBV capsid inhibitor. AB-836 inhibits viral replication by interacting with HBV core protein.
More description
|
![]() |
DC72151 | (-)-5′-Noraristeromycin |
(-)-5′-Noraristeromycin is an antiviral agent. (-)-5′-Noraristeromycin also is an enantiomer of 5'-noraristeromycin and can inhibit intracellular HBV replication and virion production. (-)-5′-Noraristeromycin can be used for the research of cancer.
More description
|
![]() |
DC71480 | Canocapavir |
Canocapavir (ZM-H1505R) has orally antiviral activity. Canocapavir is a HBV capsid inhibitor that can be used in the research of Chronic hepatitis B. .
More description
|
![]() |
DC71479 | (1R)-Tenofovir amibufenamide |
(1R)-Tenofovir amibufenamide ((1R)-HS-10234) is the isomer of Tenofovir amibufenamide, is an orally active antiviral agent. (1R)-Tenofovir amibufenamide ((1R)-HS-10234) is a HIV infection inhibitor and HBV infection inhibitor. (1R)-Tenofovir amibufenamide ((1R)-HS-10234) can be used for HIV infections, hepatitis B research.
More description
|
![]() |
DC70733 | Rencofilstat |
Rencofilstat (CRV431) is a non-immunosuppressive analogue of cyclosporine A and pan-cyclophilin inhibitor, potently inhibits cyclophilin isoforms A, B, D, and G with IC50 of 1-7 nM.Rencofilstat (CRV431) is more than 13 times more potent than the parent compound, cyclosporine A (CsA).Rencofilstat (CRV431) inhibits liver HBV DNA and HBsAg, reduces liver HBV DNA levels and moderately decreased serum HBsAg levels in HBV transgenic mouse model.Rencofilstat (CRV431) shows potential as a drug candidate for chronic liver diseases.
More description
|
![]() |
DC70167 | AB-506 |
AB-506 is a small-molecule inhibitor targeting HBV core protein, inhibits viral replication in vitro (IC50=77 nM).AB-506 binds to HBV core protein, accelerates capsid assembly and inhibits HBV pgRNA encapsidation.AB-506 blocks cccDNA establishment in HBV-infected HepG2-hNTCP-C4 cells and primary human hepatocytes, leading to inhibition of viral RNA, HBsAg, and HBeAg production (EC50=0.64-1.52 uM).AB-506 demonstrated activity across HBV genotypes A-H and maintains antiviral activity against nucleostide analog-resistant variants in vitro.AB-506 showed an 8 to 20-fold increase in EC50 values against L30F, L37Q, and I105T substitutions.AB-506 exhibits good oral bioavailability, systemic exposure, and higher liver to plasma ratios in rodents.
More description
|
![]() |
DC70166 | AB-452 |
AB-452 (AB452) is a potent, small molecule inhibitor of noncanonical poly(A) polymerases PAPD5 and PAPD7 (PAPD5/7), inhibits PAPD5/7 enzymatic activities, reduces HBsAg in vitro (EC50=1.4/6.8 nM).AB-452 demonstrated specific antiviral activity for HBV, was inactive against a panel of 10 different RNA and DNA viruses with EC50 values of >30 uM.AB-452 reduced HBsAg, HBeAg, and HBV DNA production with EC50 of 0.28-6.8 nM, without cytotoxicity.AB-452 interferes with multiple steps of HBV life cycle by reducing HBV RNA.AB-452 demonstrated antiviral activity in AAV-HBV-transduced mouse model.AB-452 promotes HBV RNA degradation through inhibiting PAPD5 and PAPD7 enzymatic activities and blockage of guanosine incorporation into viral RNA poly(A) tails..
More description
|
![]() |
DC49479 | HBV-IN-14 |
HBV-IN-14 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-14 is a pyridinopyrimidinones compound. HBV-IN-14 has the potential for the research of HBV infection (extracted from patent WO2021190502A1, compound 5).
More description
|
![]() |
DC49478 | HBV-IN-16 |
HBV-IN-16 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-16 is a quinoline derivative. HBV-IN-16 has the potential for the research of HBV infection (extracted from patent WO2019121357A1, compound 1).
More description
|
![]() |
DC49477 | SHR5133 |
SHR5133 is a highly potent, orally active HBV capsid assembly modulator. SHR5133 displays HBV DNA reduction (EC50=26.6 nM).
More description
|
![]() |
DC49476 | HBV-IN-17 |
HBV-IN-17 (compound 8) is a potent HBV capsid assembly modulator with an EC50 of 511 nM.
More description
|
![]() |
DC49475 | BA38017 |
BA38017 is a potent HBV core protein assembly modulator. BA38017 inhibits HBV replication with an EC50 of 0.20 μM.
More description
|
![]() |
DC49059 | TLR8 agonist 4 |
TLR8 agonist 4 showed effective inhibition on wild-type and drug-resistant (lamivudine and entecavir) HBV strains. The IC50 values are 0.15 and 0.10 respectively μM.
More description
|
![]() |