Doxacurium chloride (BW A938U) is a potent non-depolarizing neuromuscular blocking agent. Doxacurium chloride binds to cholinergic receptors to antagonize acetylcholine, resulting in a block of neuromuscular transmission. Doxacurium chloride can be used for the research of neurological diseases.

Triacetin, the triglyceride 1,2,3-triacetoxypropane is more generally known as triacetin and glycerin triacetate. It is the triester of glycerol and acetylating agents, such as acetic acid and acetic anhydride. It is an antifungal agent.

Cholesteryl sulfate sodium is an important regulatory molecule. Cholesterol sulfate sodium is a component of cell membranes where it has a stabilizing role and protects erythrocytes from osmotic lysis and regulating sperm capacitation.

SQDG is a glycolipid that possesses sugar moieties in their head groups. SQDG is a membrane lipid that can be used to investigate the effects of structural lipid in LNP formulations.

DPPG sodium (1,2-Dipalmitoyl-sn-glycero-3-PG sodium) is a phospholipid containing the long-chain(16:0) palmitic acid inserted at the sn-1 and sn-2 positions. DPPG sodium is used in the generation of micelles, liposomes and other types of artificial membranes.

DOPE, also known as 1,2-Dioleoyl-sn-glycero-3-PE or 1,2-DOPE, is a synthetic analog of naturally-occurring PE containing 18:1 fatty acids at the sn-1 and sn-2 positions. 1,2-DOPE can be used as an emulsifier to facilitate DNA-liposome complex transport across membranes. It is used in combination with cationic phospholipids to increase efficiency during DNA transfection studies as a non-viral method of gene delivery.

DMPG is a phospholipid containing the saturated long-chain (14:0) myristic acid.

DSPA is a form of phosphatidic acid (PA) containing a phosphatidic acid head group and 18:0 fatty acids

POPE is a phospholipid, and can be used for drug delivery.

DPPE is a derivative of phosphatidylethanolamine with (16:0) palmitoyl acyl chains

DSPE is a phosphoethanolamine (PE) lipid that can be used in the synthesis of liposomes.

1,2-Distearoyl-sn-glycero-3-PC is a phospholipid containing the saturated long-chain (18:0) stearic acid inserted at the sn-1 and sn-2 positions.

HSPC is a natural product. Hydrogenated soya phosphatidylcholines can extend drug release in regard to drug loading and solubility for oral drug delivery of watersoluble drugs.

DEPC, also known as DC22:1PC or SJN79954, is a phospholipid containing erucic acid at the sn-1 and sn-2 positions. DEPC is a useful reagent in drug formulation study. It has been used in the study of lipid membranes and to determine the effect of long-chain phospholipids on the secondary structure of human islet amyloid polypeptide (hIAPP).

1,2-Dimyristoyl-sn-glycero-3-phosphocholine (DMPC) is a synthetic phospholipid used in liposomes. 1,2-Dimyristoyl-sn-glycero-3-phosphocholine is used for the study of lipid monolayers and bilayers.

DSPG-Na is the component of liposomes for drug delivery.

DPPA is a form of phosphatidic acid (PA).

Mipomersen (ISIS 301012 free base) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen can be used for the research of homozygous familial hypercholesterolemia (HoFH). The free form of the compound is prone to instability, it is advisable to consider the stable salt form (Mipomersen sodium) that retains the same biological activity.

Lumasiran (ALN-G01), a siRNA product, reduces hepatic oxalate production by targeting glycolate oxidase. By silencing the gene encoding glycolate oxidase, Lumasiran depletes glycolate oxidase and thereby inhibits the synthesis of oxalate, which is the toxic metabolite that is directly associated with the clinical manifestations of Primary hyperoxaluria type 1 (PH1).

Inotersen is an antisense oligonucleotide that inhibits hepatic production of transthyretin (TTR). The free form of the compound is prone to instability, it is advisable to consider the stable salt form (Inotersen sodium) that retains the same biological activity.

Fomivirsen (ISIS-2922 free base) is an antisense 21 mer phosphorothioate oligonucleotide. Fomivirsen is an antiviral agent that is used cytomegalovirus retinitis (CMV) research, incluiding in AIDs. Fomivirsen binds to and degrades the mRNAs encoding CMV immediate-early 2 protein, thus inhibiting virus proliferation.

Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).

ARO-AAT is a second-generation RNAi drug. ARO-AAT consistes of a cholesterol-conjugated RNAi trigger (chol-RNAi) to selectively degrade AAT mRNA by RNAi and a melittin-derived peptide conjugated to N-acetylgalactosamine (NAG) formulated as the excipient EX1 to promote endosomal escape of the chol-RNAi in hepatocytes.

Tofersen (BIIB067) is an antisense oligonucleotide that mediates RNase H-dependent degradation of superoxide dismutase 1 (SOD1) mRNA to reduce the synthesis of SOD1 protein. Tofersen can be used for the research of amyotrophic lateral sclerosis (ALS).