- Chemicals for Life Science -

To enhance service speed and avoid tariff delays, we've opened a US warehouse. All US orders ship directly from our US facility.

Home > Inhibitors & Agonists > Antibiotics and Antivirals > HBV

Bepirovirsen

Cat. No.: DC71481 Featured

Chemical Structure

1403787-62-1

For research use only. We do not sell to patients.

We match the best price and quality on market.
Email:order@dcchemicals.com sales@dcchemicals.com
Tel:+86-021-58447131

Get Quotation Now

We are official vendor of:

More than 5000 active chemicals with high quality for research!

Field of application

Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).

Chemicals Properties Biological activity COA & MSDS Related products Datasheet

Cas No.:	1403787-62-1
Chemical Name:	Bepirovirsen
Synonyms:	Bepirovirsen
Purity:	>95%
Sotrage:	2 years -20°C Powder, 2 weeks 4°C in DMSO, 6 months -80°C in DMSO

Target:	HBV RNA
In Vivo:	Bepirovirsen (22-50 mg/kg/week; s.c. twice weekly for week 1 and once weekly for weeks 2-4) reduces hepatic HBV RNA and DNA in HBV-transgenic mice.
In Vitro:	Bepirovirsen (16-250 nM; 16 h) reduces hepatitis B virus (HBV) RNA, DNA, and viral proteins in HepG2.2.15 cells.

MSDS

TITLE	DOWNLOAD
MSDS_35716_DC71481_2411969-39-4

COA

LOT NO.	DOWNLOAD

Cat. No.	Product name	Field of application
DC71481	Bepirovirsen	Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).

Products are chemical reagents for research use only and are not intended for human use. We do not sell to patients.