Alternate TextTo enhance service speed and avoid tariff delays, we've opened a US warehouse. All US orders ship directly from our US facility.
Home > Inhibitors & Agonists

Inhibitors & Agonists

You can also try the following methods, and our professionals will serve you Customized Consultation
Cat. No. Product Name Field of Application Chemical Structure
DC71481 Bepirovirsen Featured
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).
More description
DC47285 Tofersen Featured
Tofersen (BIIB067) is an antisense oligonucleotide that mediates RNase H-dependent degradation of superoxide dismutase 1 (SOD1) mRNA to reduce the synthesis of SOD1 protein. Tofersen can be used for the research of amyotrophic lateral sclerosis (ALS).
More description
DC47291 Miravirsen Featured
Miravirsen (SPC-3649), a β-d-oxy-locked nucleic acid-modified phosphorothioate antisense oligonucleotide, inhibit the biogenesis of miR-122. Miravirsen (SPC-3649) is used in the study for HCV infections.
More description
DC43414 PT1 Featured
PT1 is an activator of AMP-activated protein kinase (AMPK) that directly activates the inactive truncated forms of AMPK monomers α1335, α1394, and α2398 in a dose-dependent manner (EC50s = ~ 8, 8, and 12 µM, respectively).
More description
DC41030 1,4-DPCA ethyl ester Featured
1,4-DPCA ethyl ester is the ethyl ester of 1,4-DPCA and can inhibit factor inhibiting HIF (FIH).
More description
DC43625 Paprotrain Featured
Reversible, non-ATP competitive inhibitor of mitotic kinesin-like protein 2 (MKLP-2)
More description
DC10921 ATH686 Featured
ATH686 (ATH-686) is a potent and selective, second-generation inhibitor of mutant FLT3 protein kinase.
More description
DC71536 FABPs ligand 6 Featured
FABPs ligand 6 (MF6) is an FABP5 and FABP7 inhibitor with KD values of 874 nM and 20 nM, respectively. FABPs ligand 6 can be used for multiple sclerosis research.
More description
DC7930 EI-1 Featured
EI1 is a potent and selective small molecule inhibitor of EZH2 with IC50 values of 15 nM and 13 nM for wild type EZH2 and EZH2 Y641F mutant, respectively.
More description
DC11370 TAK-901 Featured
TAK-901 is a non-selective Aurora kinase inhibitor (IC50s = 3.1, 10, and 4.2 nM for Aurora A, B, and C, respectively).
More description
DC71165 VY-3-135 Featured
VY-3-135 is an orally active, selective acetyl-CoA synthetase 2 (ACSS2) inhibitor with an IC50 value of 44 nM. VY-3-135 displayes no inhibitory activity towards recombinant human ACSS1 or ACSS3. VY-3-135 potently inhibits ACSS2 dependent fatty acid metabolism but has no effect on gene expression in tumors. VY-3-135 inhibits triple negative breast cancer (TNBC) tumor growth in mouse ACSS2high but not ACSS2low tumors models.
More description
A127 Rovalpituzumab Biosimilar (Anti-DLL3 Reference Antibody) Featured
Rovalpituzumab is a humanized monoclonal antibody against delta-like protein 3 (DLL3). Rovalpituzumab can be used in the synthesis of antibody-drug conjugate (ADC), Rovalpituzumab Tesirine. Rovalpituzumab has activity against small cell lung cancer (SCLC).
More description
A126 Evolocumab Biosimilar (Anti-PCSK9 Reference Antibody) Featured
Evolocumab (AMG 145) is a human monoclonal antibody that inhibits PCSK9. Evolocumab binds to the circulating PCSK9 protein, inhibiting it from binding to the LDLR. Evolocumab can be used for the research of hypercholesterolemia and atherosclerotic cardiovascular diseases.
More description
DC33111 Tesofensine(NS-2330) Featured
Tesofensine (NS-2330) is a triple monoamine reuptake inhibitor inducing a potent inhibition of the re-uptake process in the synaptic cleft of the neurotransmitters dopamine (DA; IC50=6.5 nM), norepinephrine (NE;IC50=1.7 nM), and serotonin (5-HT;IC50=11 nM), and with potentials as an anti-obesity agent. Tesofensine is a CNS acting anti-obesity agent.
More description
DC71975 TriGalNAc CBz Featured
TriGalNAc CBz is a GalNAc derivative and tri-GalNAc is an asialoglycoprotein receptor (ASGPR) ligand. TriGalNAc CBz can be used for mRNA drug delivery as well as lysosomal targeted chimerism (LYTAC) studies.
More description
DCC4967 Sucnr1-in-20 Featured
SUCNR1-IN-2 (Statement 35) is a succinate/succinate receptor 1 inhibitor for the study of neurodegenerative diseases such as neuroinflammation.
More description
DC34484 ATC0175 Featured
ATC0175 is a novel nonpeptidic and orally active melanin-concentrating hormone receptor 1 (MCHR1) antagonist.
More description
DC34410 CX-6258 Hydrochloride Featured
CX-6258 HCl is a potent, selective, and orally efficacious pan-Pim kinases inhibitor.
More description
DC74090 NCGC00378430 Featured
NCGC00378430 (Compound 8430) is a novel small molecule compound that reduces the SIX1/EYA2 interaction in vitro with IC50 of 52 uM in the Alphascreen assay.
More description
DC47422 p-SCN-Bn-DOTA Featured
p-SCN-Bn-DOTA is a bifunctional chelating agent. p-SCN-Bn-DOTA can simultaneously chelate radionuclides and link monoclonal antibody for radioimmunotherapy of tumor.
More description
DC21655 SJB7 Featured
SJB7 is a close analog of SPA70 and hPXR agonist, interacts with the ligand-binding domain (LBD) of hPXR..
More description
DC6912 Ethofibrate Featured
A combination of clofibrate and niacin, used to treat hyperlipidaemias
More description
DCAPI1029 Moguisteine Featured
Moguisteine is a novel peripheral non-narcotic antitussive drug.
More description
DC22372 Dexpramipexole Featured
A partial/full agonist of dopamine receptor with Ki of 3.9/2.2/0.5/5.1 nM for D2S/D2L/D3/D4, respeectively.
More description
DC43431 Alpinumisoflavone Featured
Alpinumisoflavone (compound 2) is a flavonoid derivative isolated from the stem bark of Erythrina lysistemon Hutch.
More description
DC43562 Wighteone Featured
Wighteone is a compound isolated from the aerial parts of Genista ephedroides.
More description
DC43534 Osajin Featured
Osajin is the major bioactive isoflavone present in the fruit of Maclura pomifera with antitumor, antioxidant and anti-inflammatory activities.
More description
DCAPI1078 Bexarotene Featured
Bexarotene (LGD1069) is a high-affinity and selective retinoid X receptors (RXR) agonist with EC50s of 33, 24, 25 nM for RXRα, RXRβ, and RXRγ, respectively. Bexarotene shows limited affinity for RAR receptors (EC50 >10000 nM)[1][2][3]. Bexarotene can be used for the research of cutaneous T-cell lymphoma.
More description
DC21039 GATA4-IN-3 Featured
A novel small molecule that inhibits GATA4/NKX2-5 transcriptional synergy with IC50 of 3 uM, with no activity on the protein kinases involved in the regulation of GATA4 phosphorylation.
More description
DC40870 Etalocib Featured
Etalocib (LY293111), an orally active leukotriene B4 receptor antagonist, inhibits the binding of [3H]LTB4, with a Ki of 25 nM. Etalocib (LY293111) prevents LTB4-induced calcium mobilization with an lC50 of 20 nM. Etalocib (LY293111) induces apoptosis.
More description

Customized Consultation X

Your information is safe with us. * Required Fields.

Your name
Company
Email
Procuct Name
Cat. No.
Remark
Verification code
Please fill out the characters in the picture
X