Alternate TextTo enhance service speed and avoid tariff delays, we've opened a US warehouse. All US orders ship directly from our US facility.
Home > Products > Featured products

Featured products

You can also try the following methods, and our professionals will serve you Customized Consultation
Cat. No. Product Name Field of Application Chemical Structure
DC66297 DSPE Featured
DSPE is a phosphoethanolamine (PE) lipid that can be used in the synthesis of liposomes.
More description
DC66715 HSPC Featured
HSPC is a natural product. Hydrogenated soya phosphatidylcholines can extend drug release in regard to drug loading and solubility for oral drug delivery of watersoluble drugs.
More description
DC67025 Mipomersen Featured
Mipomersen (ISIS 301012 free base) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen can be used for the research of homozygous familial hypercholesterolemia (HoFH). The free form of the compound is prone to instability, it is advisable to consider the stable salt form (Mipomersen sodium) that retains the same biological activity.
More description
DC47308 Lumasiran Featured
Lumasiran (ALN-G01), a siRNA product, reduces hepatic oxalate production by targeting glycolate oxidase. By silencing the gene encoding glycolate oxidase, Lumasiran depletes glycolate oxidase and thereby inhibits the synthesis of oxalate, which is the toxic metabolite that is directly associated with the clinical manifestations of Primary hyperoxaluria type 1 (PH1).
More description
DC67024 Inotersen Featured
Inotersen is an antisense oligonucleotide that inhibits hepatic production of transthyretin (TTR). The free form of the compound is prone to instability, it is advisable to consider the stable salt form (Inotersen sodium) that retains the same biological activity.
More description
DC72286 Fomivirsen Featured
Fomivirsen (ISIS-2922 free base) is an antisense 21 mer phosphorothioate oligonucleotide. Fomivirsen is an antiviral agent that is used cytomegalovirus retinitis (CMV) research, incluiding in AIDs. Fomivirsen binds to and degrades the mRNAs encoding CMV immediate-early 2 protein, thus inhibiting virus proliferation.
More description
DC71481 Bepirovirsen Featured
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).
More description
DC47306 ARO-AAT Featured
ARO-AAT is a second-generation RNAi drug. ARO-AAT consistes of a cholesterol-conjugated RNAi trigger (chol-RNAi) to selectively degrade AAT mRNA by RNAi and a melittin-derived peptide conjugated to N-acetylgalactosamine (NAG) formulated as the excipient EX1 to promote endosomal escape of the chol-RNAi in hepatocytes.
More description
DC67023 Amvuttra Featured
DC47285 Tofersen Featured
Tofersen (BIIB067) is an antisense oligonucleotide that mediates RNase H-dependent degradation of superoxide dismutase 1 (SOD1) mRNA to reduce the synthesis of SOD1 protein. Tofersen can be used for the research of amyotrophic lateral sclerosis (ALS).
More description
DC47287 Tivanisiran Featured
Tivanisiran (SYL1001) is a siRNA used for the study of dry eye disease. Tivanisiran was designed to silence transient receptor potential vanilloid 1 (TRPV1).
More description
DC47291 Miravirsen Featured
Miravirsen (SPC-3649), a β-d-oxy-locked nucleic acid-modified phosphorothioate antisense oligonucleotide, inhibit the biogenesis of miR-122. Miravirsen (SPC-3649) is used in the study for HCV infections.
More description
DC47280 Nusinersen Featured
Nusinersen is an antisense oligonucleotide drug that modifies pre–messenger RNA splicing of the SMN2 gene and thus promotes increased production of full-length SMN protein.
More description
DC67027 Onpattro Featured
DC65739 18:0-18:2 PE Featured
18:0-18:2 PE is a lipid for agents delivering. 18:0-18:2 PE is mainly composed of unsaturated fatty acids. 18:0-18:2 is considered important precursors of important odorants (IOs) in Eriocheir sinensis.
More description
DC65784 SOPA-NA(18:0-18:1 PA) Featured
DC65729 DOPG-Na Featured
DOPG-Na is a phospholipid containing the long-chain (18:1) fatty acid oleic acid inserted at the sn-1 and sn-2 positions. It can be used in the generation of micelles, liposomes, and other artificial membranes. DOPG is an anionic phospholipid derivative. The negatively charged liposomes prepared with DOPG has been found to possess the best loading capacity and encapsulation rate for Peptide Nucleic Acid (PNA) oligomers.
More description
DC67222 mPEG-5000-DPPE, Na Featured
DC65770 DMPE-mPEG2000(Na salt) Featured
DC67111 18:1 PEG2000 PE Featured
18:1 PEG2000 PE (18:1 PEG-PE) is a polyethyleneglycol/phosphatidyl-ethanolamine conjugate. 18:1 PEG2000 PE can be used for drug delivery.
More description
DC67112 DPPE-PEG2000 Featured
DPPE-PEG2000 (16:0 PEG2000 PE) is a PEG-modified lipids. 16:0 PEG2000 PE can reduce the nonspecific adsorption of protein and prolong circulation time in vivo.
More description
DC52020 ALC-0159 Featured
ALC-0159 is a PEG/lipid conjugate (i.e. PEGylated lipid). Formulations containing ALC-0159 have been used in the development of lipid nanoparticles (LNPs) for the delivery of mRNA-based vaccines.
More description
DC40169 DMG-PEG2000 Featured
DMG-PEG 2000 is used for the preparation of liposome for siRNA delivery with improved transfection efficiency in vitro. DMG-PEG 2000 is also used for the lipid nanoparticle for an oral plasmid DNA delivery approach in vivo through a facile surface modific
More description
DC60775 HEC96719 Featured
HEC96719 is a tricyclic farnesoid X receptor agonist (FXR agonist) for treatment of non-alcoholic steatohepatitis. HEC96719 exhibits excellent potency superior to GW4064 and obeticholic acid in in vitro and in vivo assays of FXR activation. It also shows higher FXR selectivity and more favorable tissue distribution dominantly in liver and intestine. Preclinical data on pharmacokinetic properties, efficacy, and safety profiles overall indicate that HEC96719 is a promising drug candidate for NASH treatment.
More description
DC43414 PT1 Featured
PT1 is an activator of AMP-activated protein kinase (AMPK) that directly activates the inactive truncated forms of AMPK monomers α1335, α1394, and α2398 in a dose-dependent manner (EC50s = ~ 8, 8, and 12 µM, respectively).
More description
DC60774 Monlunabant Featured
Monlunabant, also known as INV-202, is a potent CB1R inverse agonist. INV-202 reduced glomerular injury, preserved podocyte structure and function, reduced injury to PTECs, and ultimately reduced renal fibrosis in a streptozotocin-induced diabetic nephropathy mouse model.
More description
DC41030 1,4-DPCA ethyl ester Featured
1,4-DPCA ethyl ester is the ethyl ester of 1,4-DPCA and can inhibit factor inhibiting HIF (FIH).
More description
DC60773 Protoporphyrin IX Featured
Protoporphyrin IX is an organic compound, classified as a porphyrin, that plays an important role in living organisms as a precursor to other critical compounds like heme (hemoglobin) and chlorophyll. It is a deeply colored solid that is not soluble in water. The name is often abbreviated as PPIX. Protoporphyrin IX florescence from 5-ALA administration is used in fluorescent-guided surgery of glioblastoma. Protoporphyrin IX is an important precursor for synthesis of verteporfin, an approved photosensitizer.
More description
DC60772 MORF-627 Featured
MORF-627 is a potent, orally bioavailable, selective inhibitor that stabilizes the bent-closed form of αvβ6 with IC50 of 9.2 nM and shows good selectivity against αvβ1 and αvβ8 (230-fold and 340-fold, respectively.
More description
DC43625 Paprotrain Featured
Reversible, non-ATP competitive inhibitor of mitotic kinesin-like protein 2 (MKLP-2)
More description

Customized Consultation X

Your information is safe with us. * Required Fields.

Your name
Company
Email
Procuct Name
Cat. No.
Remark
Verification code
Please fill out the characters in the picture
X