To enhance service speed and avoid tariff delays, we've opened a US warehouse. All US orders ship directly from our US facility.
| Cat. No. | Product Name | Field of Application | Chemical Structure |
|---|---|---|---|
| DC66297 | DSPE Featured |
DSPE is a phosphoethanolamine (PE) lipid that can be used in the synthesis of liposomes.
More description
|
|
| DC66715 | HSPC Featured |
HSPC is a natural product. Hydrogenated soya phosphatidylcholines can extend drug release in regard to drug loading and solubility for oral drug delivery of watersoluble drugs.
More description
|
|
| DC67025 | Mipomersen Featured |
Mipomersen (ISIS 301012 free base) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen can be used for the research of homozygous familial hypercholesterolemia (HoFH).
The free form of the compound is prone to instability, it is advisable to consider the stable salt form (Mipomersen sodium) that retains the same biological activity.
More description
|
|
| DC47308 | Lumasiran Featured |
Lumasiran (ALN-G01), a siRNA product, reduces hepatic oxalate production by targeting glycolate oxidase. By silencing the gene encoding glycolate oxidase, Lumasiran depletes glycolate oxidase and thereby inhibits the synthesis of oxalate, which is the toxic metabolite that is directly associated with the clinical manifestations of Primary hyperoxaluria type 1 (PH1).
More description
|
|
| DC67024 | Inotersen Featured |
Inotersen is an antisense oligonucleotide that inhibits hepatic production of transthyretin (TTR).
The free form of the compound is prone to instability, it is advisable to consider the stable salt form (Inotersen sodium) that retains the same biological activity.
More description
|
|
| DC72286 | Fomivirsen Featured |
Fomivirsen (ISIS-2922 free base) is an antisense 21 mer phosphorothioate oligonucleotide. Fomivirsen is an antiviral agent that is used cytomegalovirus retinitis (CMV) research, incluiding in AIDs. Fomivirsen binds to and degrades the mRNAs encoding CMV immediate-early 2 protein, thus inhibiting virus proliferation.
More description
|
|
| DC71481 | Bepirovirsen Featured |
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).
More description
|
|
| DC47306 | ARO-AAT Featured |
ARO-AAT is a second-generation RNAi drug. ARO-AAT consistes of a cholesterol-conjugated RNAi trigger (chol-RNAi) to selectively degrade AAT mRNA by RNAi and a melittin-derived peptide conjugated to N-acetylgalactosamine (NAG) formulated as the excipient EX1 to promote endosomal escape of the chol-RNAi in hepatocytes.
More description
|
|
| DC67023 | Amvuttra Featured |
|
|
| DC47285 | Tofersen Featured |
Tofersen (BIIB067) is an antisense oligonucleotide that mediates RNase H-dependent degradation of superoxide dismutase 1 (SOD1) mRNA to reduce the synthesis of SOD1 protein. Tofersen can be used for the research of amyotrophic lateral sclerosis (ALS).
More description
|
|
| DC47287 | Tivanisiran Featured |
Tivanisiran (SYL1001) is a siRNA used for the study of dry eye disease. Tivanisiran was designed to silence transient receptor potential vanilloid 1 (TRPV1).
More description
|
|
| DC47291 | Miravirsen Featured |
Miravirsen (SPC-3649), a β-d-oxy-locked nucleic acid-modified phosphorothioate antisense oligonucleotide, inhibit the biogenesis of miR-122. Miravirsen (SPC-3649) is used in the study for HCV infections.
More description
|
|
| DC47280 | Nusinersen Featured |
Nusinersen is an antisense oligonucleotide drug that modifies pre–messenger RNA splicing of the SMN2 gene and thus promotes increased production of full-length SMN protein.
More description
|
|
| DC67027 | Onpattro Featured |
|
|
| DC65739 | 18:0-18:2 PE Featured |
18:0-18:2 PE is a lipid for agents delivering. 18:0-18:2 PE is mainly composed of unsaturated fatty acids. 18:0-18:2 is considered important precursors of important odorants (IOs) in Eriocheir sinensis.
More description
|
|
| DC65784 | SOPA-NA(18:0-18:1 PA) Featured |
|
|
| DC65729 | DOPG-Na Featured |
DOPG-Na is a phospholipid containing the long-chain (18:1) fatty acid oleic acid inserted at the sn-1 and sn-2 positions. It can be used in the generation of micelles, liposomes, and other artificial membranes. DOPG is an anionic phospholipid derivative. The negatively charged liposomes prepared with DOPG has been found to possess the best loading capacity and encapsulation rate for Peptide Nucleic Acid (PNA) oligomers.
More description
|
|
| DC67222 | mPEG-5000-DPPE, Na Featured |
|
|
| DC65770 | DMPE-mPEG2000(Na salt) Featured |
|
|
| DC67111 | 18:1 PEG2000 PE Featured |
18:1 PEG2000 PE (18:1 PEG-PE) is a polyethyleneglycol/phosphatidyl-ethanolamine conjugate. 18:1 PEG2000 PE can be used for drug delivery.
More description
|
|
| DC67112 | DPPE-PEG2000 Featured |
DPPE-PEG2000 (16:0 PEG2000 PE) is a PEG-modified lipids. 16:0 PEG2000 PE can reduce the nonspecific adsorption of protein and prolong circulation time in vivo.
More description
|
|
| DC52020 | ALC-0159 Featured |
ALC-0159 is a PEG/lipid conjugate (i.e. PEGylated lipid). Formulations containing ALC-0159 have been used in the development of lipid nanoparticles (LNPs) for the delivery of mRNA-based vaccines.
More description
|
|
| DC40169 | DMG-PEG2000 Featured |
DMG-PEG 2000 is used for the preparation of liposome for siRNA delivery with improved transfection efficiency in vitro. DMG-PEG 2000 is also used for the lipid nanoparticle for an oral plasmid DNA delivery approach in vivo through a facile surface modific
More description
|
|
| DC60775 | HEC96719 Featured |
HEC96719 is a tricyclic farnesoid X receptor agonist (FXR agonist) for treatment of non-alcoholic steatohepatitis. HEC96719 exhibits excellent potency superior to GW4064 and obeticholic acid in in vitro and in vivo assays of FXR activation. It also shows higher FXR selectivity and more favorable tissue distribution dominantly in liver and intestine. Preclinical data on pharmacokinetic properties, efficacy, and safety profiles overall indicate that HEC96719 is a promising drug candidate for NASH treatment.
More description
|
|
| DC43414 | PT1 Featured |
PT1 is an activator of AMP-activated protein kinase (AMPK) that directly activates the inactive truncated forms of AMPK monomers α1335, α1394, and α2398 in a dose-dependent manner (EC50s = ~ 8, 8, and 12 µM, respectively).
More description
|
|
| DC60774 | Monlunabant Featured |
Monlunabant, also known as INV-202, is a potent CB1R inverse agonist. INV-202 reduced glomerular injury, preserved podocyte structure and function, reduced injury to PTECs, and ultimately reduced renal fibrosis in a streptozotocin-induced diabetic nephropathy mouse model.
More description
|
|
| DC41030 | 1,4-DPCA ethyl ester Featured |
1,4-DPCA ethyl ester is the ethyl ester of 1,4-DPCA and can inhibit factor inhibiting HIF (FIH).
More description
|
|
| DC60773 | Protoporphyrin IX Featured |
Protoporphyrin IX is an organic compound, classified as a porphyrin, that plays an important role in living organisms as a precursor to other critical compounds like heme (hemoglobin) and chlorophyll. It is a deeply colored solid that is not soluble in water. The name is often abbreviated as PPIX. Protoporphyrin IX florescence from 5-ALA administration is used in fluorescent-guided surgery of glioblastoma. Protoporphyrin IX is an important precursor for synthesis of verteporfin, an approved photosensitizer.
More description
|
|
| DC60772 | MORF-627 Featured |
MORF-627 is a potent, orally bioavailable, selective inhibitor that stabilizes the bent-closed form of αvβ6 with IC50 of 9.2 nM and shows good selectivity against αvβ1 and αvβ8 (230-fold and 340-fold, respectively.
More description
|
|
| DC43625 | Paprotrain Featured |
Reversible, non-ATP competitive inhibitor of mitotic kinesin-like protein 2 (MKLP-2)
More description
|
|