Salcaprozate sodium (SNAC), an oral absorption promoter, and has the potential as a delivery agent for oral forms of heparin and insulin. Salcaprozate sodium could increase passive transcellular permeation across small intestinal epithelia based on increased lipophilicity arising from non-covalent macromolecule complexation.

DL-alpha-Tocopherol is a synthetic vitamin E, with antioxidation effect. DL-alpha-Tocopherol protects human skin fibroblasts against the cytotoxic effect of UVB.

D-(+)-Trehalose dihydrate can be used as a food ingredient and pharmaceutical excipient.

Ascorbyl palmitate is an ester formed from ascorbic acid and palmitic acid creating a fat-soluble form of vitamin C.

Succinic anhydride is a cyclic anhydride and a nonclaevable ADC linker extracted from patent WO2009064913A1. Succinic anhydride can react with compound 4 of the patent to link the proagent to an amine or hydroxy 1 group of a targeting polypeptide.

Lauroylsarcosine sodium is a surfactant commonly used in personal care and cosmetics such as shampoos, facial cleansers and toothpaste. It works by lowering the surface tension of water, allowing it to better penetrate and clean surfaces. Lauroylsarcosine sodium is considered safe for cosmetic use and is approved for use in several countries. However, it can cause skin irritation in high concentrations or with prolonged exposure.

Doxacurium chloride (BW A938U) is a potent non-depolarizing neuromuscular blocking agent. Doxacurium chloride binds to cholinergic receptors to antagonize acetylcholine, resulting in a block of neuromuscular transmission. Doxacurium chloride can be used for the research of neurological diseases.

Triacetin, the triglyceride 1,2,3-triacetoxypropane is more generally known as triacetin and glycerin triacetate. It is the triester of glycerol and acetylating agents, such as acetic acid and acetic anhydride. It is an antifungal agent.

Cholesteryl sulfate sodium is an important regulatory molecule. Cholesterol sulfate sodium is a component of cell membranes where it has a stabilizing role and protects erythrocytes from osmotic lysis and regulating sperm capacitation.

SQDG is a glycolipid that possesses sugar moieties in their head groups. SQDG is a membrane lipid that can be used to investigate the effects of structural lipid in LNP formulations.

DPPG sodium (1,2-Dipalmitoyl-sn-glycero-3-PG sodium) is a phospholipid containing the long-chain(16:0) palmitic acid inserted at the sn-1 and sn-2 positions. DPPG sodium is used in the generation of micelles, liposomes and other types of artificial membranes.

DMPG is a phospholipid containing the saturated long-chain (14:0) myristic acid.

DSPA is a form of phosphatidic acid (PA) containing a phosphatidic acid head group and 18:0 fatty acids

POPE is a phospholipid, and can be used for drug delivery.

DSPE is a phosphoethanolamine (PE) lipid that can be used in the synthesis of liposomes.

HSPC is a natural product. Hydrogenated soya phosphatidylcholines can extend drug release in regard to drug loading and solubility for oral drug delivery of watersoluble drugs.

Mipomersen (ISIS 301012 free base) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen can be used for the research of homozygous familial hypercholesterolemia (HoFH). The free form of the compound is prone to instability, it is advisable to consider the stable salt form (Mipomersen sodium) that retains the same biological activity.

Lumasiran (ALN-G01), a siRNA product, reduces hepatic oxalate production by targeting glycolate oxidase. By silencing the gene encoding glycolate oxidase, Lumasiran depletes glycolate oxidase and thereby inhibits the synthesis of oxalate, which is the toxic metabolite that is directly associated with the clinical manifestations of Primary hyperoxaluria type 1 (PH1).

Inotersen is an antisense oligonucleotide that inhibits hepatic production of transthyretin (TTR). The free form of the compound is prone to instability, it is advisable to consider the stable salt form (Inotersen sodium) that retains the same biological activity.

Fomivirsen (ISIS-2922 free base) is an antisense 21 mer phosphorothioate oligonucleotide. Fomivirsen is an antiviral agent that is used cytomegalovirus retinitis (CMV) research, incluiding in AIDs. Fomivirsen binds to and degrades the mRNAs encoding CMV immediate-early 2 protein, thus inhibiting virus proliferation.

Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).

ARO-AAT is a second-generation RNAi drug. ARO-AAT consistes of a cholesterol-conjugated RNAi trigger (chol-RNAi) to selectively degrade AAT mRNA by RNAi and a melittin-derived peptide conjugated to N-acetylgalactosamine (NAG) formulated as the excipient EX1 to promote endosomal escape of the chol-RNAi in hepatocytes.

Tofersen (BIIB067) is an antisense oligonucleotide that mediates RNase H-dependent degradation of superoxide dismutase 1 (SOD1) mRNA to reduce the synthesis of SOD1 protein. Tofersen can be used for the research of amyotrophic lateral sclerosis (ALS).