Alternate TextTo enhance service speed and avoid tariff delays, we've opened a US warehouse. All US orders ship directly from our US facility.
Home > Products

Products

You can also try the following methods, and our professionals will serve you Customized Consultation
Cat. No. Product Name Field of Application Chemical Structure
DC40207 Salcaprozate sodium
Salcaprozate sodium (SNAC), an oral absorption promoter, and has the potential as a delivery agent for oral forms of heparin and insulin. Salcaprozate sodium could increase passive transcellular permeation across small intestinal epithelia based on increased lipophilicity arising from non-covalent macromolecule complexation.
More description
DC66720 DL-alpha-Tocopherol
DL-alpha-Tocopherol is a synthetic vitamin E, with antioxidation effect. DL-alpha-Tocopherol protects human skin fibroblasts against the cytotoxic effect of UVB.
More description
DC12296 D-(+)-Trehalose dihydrate
D-(+)-Trehalose dihydrate can be used as a food ingredient and pharmaceutical excipient.
More description
DCAPI1060 L-Ascorbyl 6-palmitate
Ascorbyl palmitate is an ester formed from ascorbic acid and palmitic acid creating a fat-soluble form of vitamin C.
More description
DC66731 Succinic anhydride
Succinic anhydride is a cyclic anhydride and a nonclaevable ADC linker extracted from patent WO2009064913A1. Succinic anhydride can react with compound 4 of the patent to link the proagent to an amine or hydroxy 1 group of a targeting polypeptide.
More description
DC66722 Lauroylsarcosine sodium
Lauroylsarcosine sodium is a surfactant commonly used in personal care and cosmetics such as shampoos, facial cleansers and toothpaste. It works by lowering the surface tension of water, allowing it to better penetrate and clean surfaces. Lauroylsarcosine sodium is considered safe for cosmetic use and is approved for use in several countries. However, it can cause skin irritation in high concentrations or with prolonged exposure.
More description
DC66721 Poly(sodium 4-styrenesulfonate)
DC66733 Doxacurium chloride
Doxacurium chloride (BW A938U) is a potent non-depolarizing neuromuscular blocking agent. Doxacurium chloride binds to cholinergic receptors to antagonize acetylcholine, resulting in a block of neuromuscular transmission. Doxacurium chloride can be used for the research of neurological diseases.
More description
DC37120 Triacetin
Triacetin, the triglyceride 1,2,3-triacetoxypropane is more generally known as triacetin and glycerin triacetate. It is the triester of glycerol and acetylating agents, such as acetic acid and acetic anhydride. It is an antifungal agent.
More description
DC66730 Cholesteryl sulfate sodium
Cholesteryl sulfate sodium is an important regulatory molecule. Cholesterol sulfate sodium is a component of cell membranes where it has a stabilizing role and protects erythrocytes from osmotic lysis and regulating sperm capacitation.
More description
A166 LY2787106 Biosimilar(Anti-Hepcidin / HAMP Reference Antibody) Featured
DC60363 DOSPER Featured
DC60358 EDOPC Featured
DC71118 SQDG Featured
SQDG is a glycolipid that possesses sugar moieties in their head groups. SQDG is a membrane lipid that can be used to investigate the effects of structural lipid in LNP formulations.
More description
DC60367 EDLPC Featured
DC49194 DPPG sodium Featured
DPPG sodium (1,2-Dipalmitoyl-sn-glycero-3-PG sodium) is a phospholipid containing the long-chain(16:0) palmitic acid inserted at the sn-1 and sn-2 positions. DPPG sodium is used in the generation of micelles, liposomes and other types of artificial membranes.
More description
DC65727 DMPG Featured
DMPG is a phospholipid containing the saturated long-chain (14:0) myristic acid.
More description
DC65728 DSPA Featured
DSPA is a form of phosphatidic acid (PA) containing a phosphatidic acid head group and 18:0 fatty acids
More description
DC67113 DPPE-DBCO Featured
DC65745 POPE Featured
POPE is a phospholipid, and can be used for drug delivery.
More description
DC66297 DSPE Featured
DSPE is a phosphoethanolamine (PE) lipid that can be used in the synthesis of liposomes.
More description
DC66715 HSPC Featured
HSPC is a natural product. Hydrogenated soya phosphatidylcholines can extend drug release in regard to drug loading and solubility for oral drug delivery of watersoluble drugs.
More description
DC67025 Mipomersen Featured
Mipomersen (ISIS 301012 free base) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen can be used for the research of homozygous familial hypercholesterolemia (HoFH). The free form of the compound is prone to instability, it is advisable to consider the stable salt form (Mipomersen sodium) that retains the same biological activity.
More description
DC47308 Lumasiran Featured
Lumasiran (ALN-G01), a siRNA product, reduces hepatic oxalate production by targeting glycolate oxidase. By silencing the gene encoding glycolate oxidase, Lumasiran depletes glycolate oxidase and thereby inhibits the synthesis of oxalate, which is the toxic metabolite that is directly associated with the clinical manifestations of Primary hyperoxaluria type 1 (PH1).
More description
DC67024 Inotersen Featured
Inotersen is an antisense oligonucleotide that inhibits hepatic production of transthyretin (TTR). The free form of the compound is prone to instability, it is advisable to consider the stable salt form (Inotersen sodium) that retains the same biological activity.
More description
DC72286 Fomivirsen Featured
Fomivirsen (ISIS-2922 free base) is an antisense 21 mer phosphorothioate oligonucleotide. Fomivirsen is an antiviral agent that is used cytomegalovirus retinitis (CMV) research, incluiding in AIDs. Fomivirsen binds to and degrades the mRNAs encoding CMV immediate-early 2 protein, thus inhibiting virus proliferation.
More description
DC71481 Bepirovirsen Featured
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).
More description
DC47306 ARO-AAT Featured
ARO-AAT is a second-generation RNAi drug. ARO-AAT consistes of a cholesterol-conjugated RNAi trigger (chol-RNAi) to selectively degrade AAT mRNA by RNAi and a melittin-derived peptide conjugated to N-acetylgalactosamine (NAG) formulated as the excipient EX1 to promote endosomal escape of the chol-RNAi in hepatocytes.
More description
DC67023 Amvuttra Featured
DC47285 Tofersen Featured
Tofersen (BIIB067) is an antisense oligonucleotide that mediates RNase H-dependent degradation of superoxide dismutase 1 (SOD1) mRNA to reduce the synthesis of SOD1 protein. Tofersen can be used for the research of amyotrophic lateral sclerosis (ALS).
More description

Customized Consultation X

Your information is safe with us. * Required Fields.

Your name
Company
Email
Procuct Name
Cat. No.
Remark
Verification code
Please fill out the characters in the picture
X