To enhance service speed and avoid tariff delays, we've opened a US warehouse. All US orders ship directly from our US facility.
| Cat. No. | Product Name | Field of Application | Chemical Structure |
|---|---|---|---|
| A176 | SAIT301 Biosimilar(Anti-HGFR / c-Met Reference Antibody) Featured |
|
|
| A175 | Telisotuzumab Biosimilar(Anti-HGFR / c-Met Reference Antibody) Featured |
Telisotuzumab (ABT-700) is a human recombinant bivalent antibody, a therapeutic antibody against the hepatocyte growth factor receptor (MET) that binds c-Met with high affinity and inhibits c-Met signaling. Telisotuzumab has antitumor activity.
More description
|
|
| A174 | Emibetuzumab Biosimilar(Anti-HGFR / c-Met Reference Antibody) Featured |
Emibetuzumab (LY2875358) is a humanized bivalent MET antibody (IgG4 type). Emibetuzumab shows high neutralization and internalization activities, resulting in inhibition of both HGF-dependent and HGF-independent MET pathway activation and tumor growth. Emibetuzumab can be used in study of cancer.
More description
|
|
| A173 | Onartuzumab Biosimilar(Anti-HGFR / c-Met Reference Antibody) Featured |
Onartuzumab (MetMAb) is a unique, humanized and affinity-matured monovalent (one-armed) monoclonal antibody against the MET receptor. Onartuzumab potently inhibits HGF binding and receptor phosphorylation and signaling. Onartuzumab has antibody-like pharmacokinetics and antitumor activity.
More description
|
|
| A172 | Amivantamab Biosimilar(Anti-HGFR / c-Met Reference Antibody) Featured |
Amivantamab (JNJ-61186372) is a human EGFR-MET bispecific antibody with immune anticancer activity. Amivantamab inhibits ligand binding, promotes endocytosis and degradation of receptor-antibody complexes, and induces Fc-dependent cytokinesis in macrophages and antibody-dependent cytotoxicity in natural killer cells.
More description
|
|
| A171 | Genentech patent anti-HGFA Biosimilar(Anti-HGFA Reference Antibody) Featured |
|
|
| A170 | Ficlatuzumab Biosimilar(Anti-HGF / SF Reference Antibody) Featured |
Ficlatuzumab is a monoclonal antibody (McAb) targeting human hepatocyte growth factor (HGF). Ficlatuzumab blocks the activation of the HGF/c-Met signaling pathway, and inhibits c-Met receptor-mediated cancer cell proliferation, migration, and invasion.
More description
|
|
| A169 | Rilotumumab Biosimilar(Anti-HGF / SF Reference Antibody) Featured |
Rilotumumab (AMG 102) is an anti-HGF (anti-hepatocyte growth factor) monoclonal antibody, inhibits HGF/MET-driven signaling. Rilotumumab shows anti-tumor activity, and can be used in castration-resistant prostate cancer (CRPC) and solid tumor research.
More description
|
|
| A168 | TAK-701 Biosimilar(Anti-HGF / SF Reference Antibody) Featured |
|
|
| A167 | Ludwig-Maximilians U. anti_Hepsin Biosimilar(Anti-Hepcidin / HAMP Reference Antibody) Featured |
|
|
| DC22902 | SNC-80 Featured |
SNC80 (NIH 10815) is a potent, highly selective and non-peptide δ-opioid receptor agonist with a Ki of 1.78 nM and an IC50 of 2.73 nM. SNC80 also selectively activates μ-δ heteromer in HEK293 cells with an EC50 of 52.8 nM. SNC80 shows antinociceptive, antihyperalgesic and antidepressant‐like effects. SNC80 has the potential for multiple headache disorders treatment.
More description
|
|
| A166 | LY2787106 Biosimilar(Anti-Hepcidin / HAMP Reference Antibody) Featured |
|
|
| DC60363 | DOSPER Featured |
|
|
| DC71118 | SQDG Featured |
SQDG is a glycolipid that possesses sugar moieties in their head groups. SQDG is a membrane lipid that can be used to investigate the effects of structural lipid in LNP formulations.
More description
|
|
| DC60367 | EDLPC Featured |
|
|
| DC49194 | DPPG sodium Featured |
DPPG sodium (1,2-Dipalmitoyl-sn-glycero-3-PG sodium) is a phospholipid containing the long-chain(16:0) palmitic acid inserted at the sn-1 and sn-2 positions. DPPG sodium is used in the generation of micelles, liposomes and other types of artificial membranes.
More description
|
|
| DC65727 | DMPG Featured |
DMPG is a phospholipid containing the saturated long-chain (14:0) myristic acid.
More description
|
|
| DC65728 | DSPA Featured |
DSPA is a form of phosphatidic acid (PA) containing a phosphatidic acid head group and 18:0 fatty acids
More description
|
|
| DC67113 | DPPE-DBCO Featured |
|
|
| DC65745 | POPE Featured |
POPE is a phospholipid, and can be used for drug delivery.
More description
|
|
| DC66297 | DSPE Featured |
DSPE is a phosphoethanolamine (PE) lipid that can be used in the synthesis of liposomes.
More description
|
|
| DC66715 | HSPC Featured |
HSPC is a natural product. Hydrogenated soya phosphatidylcholines can extend drug release in regard to drug loading and solubility for oral drug delivery of watersoluble drugs.
More description
|
|
| DC67025 | Mipomersen Featured |
Mipomersen (ISIS 301012 free base) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen can be used for the research of homozygous familial hypercholesterolemia (HoFH).
The free form of the compound is prone to instability, it is advisable to consider the stable salt form (Mipomersen sodium) that retains the same biological activity.
More description
|
|
| DC47308 | Lumasiran Featured |
Lumasiran (ALN-G01), a siRNA product, reduces hepatic oxalate production by targeting glycolate oxidase. By silencing the gene encoding glycolate oxidase, Lumasiran depletes glycolate oxidase and thereby inhibits the synthesis of oxalate, which is the toxic metabolite that is directly associated with the clinical manifestations of Primary hyperoxaluria type 1 (PH1).
More description
|
|
| DC67024 | Inotersen Featured |
Inotersen is an antisense oligonucleotide that inhibits hepatic production of transthyretin (TTR).
The free form of the compound is prone to instability, it is advisable to consider the stable salt form (Inotersen sodium) that retains the same biological activity.
More description
|
|
| DC72286 | Fomivirsen Featured |
Fomivirsen (ISIS-2922 free base) is an antisense 21 mer phosphorothioate oligonucleotide. Fomivirsen is an antiviral agent that is used cytomegalovirus retinitis (CMV) research, incluiding in AIDs. Fomivirsen binds to and degrades the mRNAs encoding CMV immediate-early 2 protein, thus inhibiting virus proliferation.
More description
|
|
| DC71481 | Bepirovirsen Featured |
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).
More description
|
|
| DC47306 | ARO-AAT Featured |
ARO-AAT is a second-generation RNAi drug. ARO-AAT consistes of a cholesterol-conjugated RNAi trigger (chol-RNAi) to selectively degrade AAT mRNA by RNAi and a melittin-derived peptide conjugated to N-acetylgalactosamine (NAG) formulated as the excipient EX1 to promote endosomal escape of the chol-RNAi in hepatocytes.
More description
|
|
| DC67023 | Amvuttra Featured |
|
|
| DC47285 | Tofersen Featured |
Tofersen (BIIB067) is an antisense oligonucleotide that mediates RNase H-dependent degradation of superoxide dismutase 1 (SOD1) mRNA to reduce the synthesis of SOD1 protein. Tofersen can be used for the research of amyotrophic lateral sclerosis (ALS).
More description
|
|