SQDG is a glycolipid that possesses sugar moieties in their head groups. SQDG is a membrane lipid that can be used to investigate the effects of structural lipid in LNP formulations.

DPPG sodium (1,2-Dipalmitoyl-sn-glycero-3-PG sodium) is a phospholipid containing the long-chain(16:0) palmitic acid inserted at the sn-1 and sn-2 positions. DPPG sodium is used in the generation of micelles, liposomes and other types of artificial membranes.

DMPG is a phospholipid containing the saturated long-chain (14:0) myristic acid.

DSPA is a form of phosphatidic acid (PA) containing a phosphatidic acid head group and 18:0 fatty acids

POPE is a phospholipid, and can be used for drug delivery.

DSPE is a phosphoethanolamine (PE) lipid that can be used in the synthesis of liposomes.

HSPC is a natural product. Hydrogenated soya phosphatidylcholines can extend drug release in regard to drug loading and solubility for oral drug delivery of watersoluble drugs.

Mipomersen (ISIS 301012 free base) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen can be used for the research of homozygous familial hypercholesterolemia (HoFH). The free form of the compound is prone to instability, it is advisable to consider the stable salt form (Mipomersen sodium) that retains the same biological activity.

Lumasiran (ALN-G01), a siRNA product, reduces hepatic oxalate production by targeting glycolate oxidase. By silencing the gene encoding glycolate oxidase, Lumasiran depletes glycolate oxidase and thereby inhibits the synthesis of oxalate, which is the toxic metabolite that is directly associated with the clinical manifestations of Primary hyperoxaluria type 1 (PH1).

Inotersen is an antisense oligonucleotide that inhibits hepatic production of transthyretin (TTR). The free form of the compound is prone to instability, it is advisable to consider the stable salt form (Inotersen sodium) that retains the same biological activity.

Fomivirsen (ISIS-2922 free base) is an antisense 21 mer phosphorothioate oligonucleotide. Fomivirsen is an antiviral agent that is used cytomegalovirus retinitis (CMV) research, incluiding in AIDs. Fomivirsen binds to and degrades the mRNAs encoding CMV immediate-early 2 protein, thus inhibiting virus proliferation.

Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).

ARO-AAT is a second-generation RNAi drug. ARO-AAT consistes of a cholesterol-conjugated RNAi trigger (chol-RNAi) to selectively degrade AAT mRNA by RNAi and a melittin-derived peptide conjugated to N-acetylgalactosamine (NAG) formulated as the excipient EX1 to promote endosomal escape of the chol-RNAi in hepatocytes.

Tofersen (BIIB067) is an antisense oligonucleotide that mediates RNase H-dependent degradation of superoxide dismutase 1 (SOD1) mRNA to reduce the synthesis of SOD1 protein. Tofersen can be used for the research of amyotrophic lateral sclerosis (ALS).

Tivanisiran (SYL1001) is a siRNA used for the study of dry eye disease. Tivanisiran was designed to silence transient receptor potential vanilloid 1 (TRPV1).

Miravirsen (SPC-3649), a β-d-oxy-locked nucleic acid-modified phosphorothioate antisense oligonucleotide, inhibit the biogenesis of miR-122. Miravirsen (SPC-3649) is used in the study for HCV infections.

Nusinersen is an antisense oligonucleotide drug that modifies pre–messenger RNA splicing of the SMN2 gene and thus promotes increased production of full-length SMN protein.

18:0-18:2 PE is a lipid for agents delivering. 18:0-18:2 PE is mainly composed of unsaturated fatty acids. 18:0-18:2 is considered important precursors of important odorants (IOs) in Eriocheir sinensis.

DOPG-Na is a phospholipid containing the long-chain (18:1) fatty acid oleic acid inserted at the sn-1 and sn-2 positions. It can be used in the generation of micelles, liposomes, and other artificial membranes. DOPG is an anionic phospholipid derivative. The negatively charged liposomes prepared with DOPG has been found to possess the best loading capacity and encapsulation rate for Peptide Nucleic Acid (PNA) oligomers.

18:1 PEG2000 PE (18:1 PEG-PE) is a polyethyleneglycol/phosphatidyl-ethanolamine conjugate. 18:1 PEG2000 PE can be used for drug delivery.

DPPE-PEG2000 (16:0 PEG2000 PE) is a PEG-modified lipids. 16:0 PEG2000 PE can reduce the nonspecific adsorption of protein and prolong circulation time in vivo.

ALC-0159 is a PEG/lipid conjugate (i.e. PEGylated lipid). Formulations containing ALC-0159 have been used in the development of lipid nanoparticles (LNPs) for the delivery of mRNA-based vaccines.

DMG-PEG 2000 is used for the preparation of liposome for siRNA delivery with improved transfection efficiency in vitro. DMG-PEG 2000 is also used for the lipid nanoparticle for an oral plasmid DNA delivery approach in vivo through a facile surface modific